Human Variation & Race

1. Throughout our lifetime humans have encountered many different types of environmental stresses. High altitude is definitely one that has affected the survival of humans greatly. Homeostasis is the body’s internal setting and when its development is kept constant. So when it comes to high altitude affecting the homeostasis of a human, there are a few different aspects in humans strain us. These strains are strong winds that result in dehydration, low air pressure which makes it harder to breathe and could result in hypoxia, and extremely hot days with extremely cold nights. Dehydration, hypoxia and extreme temperatures all disturb a humans’ homeostasis by changing the way they would need to adapt in order to survive.

2.  Four ways in which humans have adapted to high altitude are by having children in the higher altitudes like the Ethiopians and the andes in tibet have,so that they produced children with greater lung and heart capacity, exercising and getting used to exercising in the higher altitude, moving to another location established at a lower altitude, and developing stronger lungs and hearts. Environments like extreme cold and high mountains have exposed more air pressured. this is the cause of natural selection.

3. The benefit of studying human variation from this perspective across environmental clines is that we obtain more information based upon factual evidence than from the opinion of races. Yes, this information helps everyone to better understand the effects of these stresses so that we can help prevent the problems that come with it.

4.Race cannot be used to understand the variation of the adaptations I listed for number two because they do not influence those adaptations at all. Environmental influences provide stronger evidence of the affects of the environments humans live in than the races of humans. natural selection will always affect us. due to living in a comfortable environment it is hard for us to adapt or even evolve.

Language Post

I found this assignment to be a lot harder than i expected, it was really difficult to converse with my brother since i was not able to speak. I was using hand gestures and grunting noises just agreeing or disagreeing with what  we were talking about. it kind 0f helped that my brother knew from the get go that he would have to do all the talking. i would use body movement to communicate with him by either shrugging or nodding my head. Just by him asking me all the questions it was made a lot easier for us to talk, it wasn't so complex just more of him asking me simple questions where it didn't require me to do much but just say yes or no by my body movement and head movement.  My brother was definitely in control of the conversation.

i would definitely say that the culture who uses symbolic language would have an advantage over a primitive culture that did not have a symbolic language. Just as i talked about my brother having a difficult time trying to communicate with me, since i didn't really have much i could say with only noises and body movement. i would have to say sign language in general because even tho it is still considered to be a symbolic language it would still be hard to try and communicate with someone who was deaf or hearing impaired. just by the fact that if you don't know sign language how will you get through to that person? with that person knowing they would probably try and figure out a different alternative to try and communicate with that person. luckily for me i am bilingual and know sign language because of my cousin who is deaf i think i would have a harder time trying to communicate with someone who spoke a different language other than the ones i already know.

Part II

yes i definitely couldn't last 15 minutes only using symbolic language just by the fact that i couldn't change my tone of voice depending on what mood i was in whether i was happy, sad, angry. i felt like a zombie just dead or a machine either or.  it felt weird talking and not being able to use my hands or make any facial expressions.  i think after a certain period my partner began talking the same way as i was without even realizing it since i figured it was because of the tone i was using i didn't raise my voice nor did i whisper i think they thought i was trying to have a serious conversation by it.

All in all i think this experiment has shown how important it is to communicate with hand gesture facial expression tone of voice. these all kind of set the mood on what kind of conversation you want to have either a serious one, a sad one, a meaningful one. i think by that alone it makes you sound more convincing.  You really don't realize how much you use it until you can no longer use it anymore. I think body language is the most important part in communication you can tell a lot by body language their facial expression or way they stand tell you a lot of what mood they are in. so if a blind person where to try and talk with you they would probably end up taking what you say the wrong way since they can't see you.

Piltdown Hoax

The piltdown hoax was a fossilized skull found about a hundred years ago or so in Britain, which was hailed as the missing link between apes and humans. This skull was discovered by Charles Dawson and Sir Arthur Smith Woodward on Valentine's Day, February 14th 1912. This astounding finding took place in Barkham Manor near the village of Piltdown, England. The significance of this scientific finding could of been such a big deal, to know they had found an artifact that could of connected our early ancestry with humans and apes, a creature that could of been part ape and part human. it would of all made sense and Darwin's theory of evolution could of been proven, our origins would of been easier to understand now than just having these theories that we evolved, branched off of, etc... The Hoax was discovered by Kenneth Oakley when he did a chemical test to help authenticate the bones and determine the date of the fossil. The teeth of the skull that had been filed down were from an actual old ape, it had no relation to the fossil they were actually looking for. Conan Doyle was the one who brought in spiritualism,the scientist were paleontologists and they appalled at the fact that they were bamboozled.

The human faults that come into play are egotism, pride, ambition, and rivalry these faults impact the scientific process because as it goes to show when there is a rivalry between "men" it can make you do almost anything just to prove you are better or smarter. In this case the scientist decided to forge an artifact that at that time had some serious meaning it could of changed things for humanity but now we will never know. with these faults it'll almost make you do anything just to prove you are better.

Kenneth Oakley applied a chemical test to help authenticate and date the fossils. The result revealed Piltdown Man to be much younger than expected. What was responsible for it was In the mineral department, tests were carried out to estimate the nitrogen content. When they tested the Piltdown remains, it resulted that the skull was in fact fake. The skull was not as old as they thought and the teeth had been filed down, it was just sort of a old ape jaw. Oakley revealed a forgery on a scale that had never been seen before. The jaw was not even human, he figured out that the jaw was probably an Orangutan's. The teeth had simply been filed flat to disguise them. The fossils had been boiled and carefully stained with chemicals to give them an aged look. But the canine tooth, one of the key discoveries, seemed to have been made in a rush. It was crudely filed and colored with paint.

I don't think it possible to remove the human factor because it is important and will always be used since we like to examine the relationships between humans and how they connect with our environment. i wouldn't' remove it because we need that in our scientific methods. It might make errors here and there but it still helps build up the method from scratch. By focusing on improving efficiency, creativity, productivity and job satisfaction, with the goal of minimizing errors. 

The lesson i took from this is that always make sure you verify with the right people that certain artifacts are legitimately genuine before you announce to the world you have made the biggest discovery ever known to man. never believe someone just because they said it they have to show facts and proof. Always look back at their previous findings and always question their credibility, as to who are they, what are they known for, etc..

Comparative Primate Blog Post

Almost all primates to some degree are quadrupedal which use all four limbs to support the body during locomotion. Most Primates use more than four of locomotion because of the generalized pattern of their anatomy.  

Locomotor Patterns

Lemurs (Prosimians/Strepsirhini):    The locomotion of lemurs depends on the different species.

Sloth lemurs: Sloth-like suspensory locomotion

Mesopropithecus: Slow arboreal quadrupedal

Indris: Vertical clinging and leaping

Bamboo lemurs: Vertical clinging and leaping

True lemurs: Fast arboreal quadrupedal

Ring-tailed Lemur: Partially terrestrial quadrupedal

Monkey lemurs: Highly terrestrial quadrupedal

Ruffed lemurs: Fast arboreal quadrupedal

Spider Monkey (New World Monkey/Platyrrhini):.

Spider monkeys are quadrupedal they use all four limbs when walking and running. They also use suspensory locomotion used when hanging, climbing or moving through the trees and bipedalism, using only two limbs when leaping. Spider monkeys use their tails and other limbs for balance

Baboon (Old World Monkey/Cercopithecidae):

 Baboons are quadruped since they walk on their toes and heels.

Gibbon (Lesser ape/Hylobatidae):

Brachiation as They move by swinging from one hold to another by arms. They are adapted for this locomotion; they use the length of their forelimbs, hook- like fingers and mobility of their shoulders.

Chimpanzee (Great ape/Hominidae): 

they usually walk on their feet and on their knuckles. they can also walk upright when they need to hold an object but for the majority of the time they walk on all four limbs.

2A. Lemurs (Prosimians/Strepsirhini)   Lemurs live in the tropical forest of Madagascar. lemurs are exclusive to the forest on the island of Madagascar and are found nowhere else (naturally) on earth. They are found primarily in the secondary forests.

Spider Monkey (New World Monkey/Platyrrhini)         Spider monkeys reside in the tropical forests of Central and South America. They are found all the way from Southern Mexico to Brazil in said tropical rainforests. Spider monkeys need large areas of moist evergreen forests and prefer undisturbed primary forest. They live in the upper layers of the rainforest and forage in the high canopy.

Baboon (Old World Monkey/Cercopithecidae)

       Baboons are primarily found in lower-central part of Africa. They reside in Zambia, Botswana, Democratic Republic of Congo, and Mozambique. They prefer African woodland savannas.   

Gibbon (Lesser ape/Hylobatidae)          Gibbons are found in tropical and subtropical rainforests from northeast India to Indonesia, northern and southern China, including the islands of Sumatra, Borneo, and Java.

Chimpanzee (Great ape/Hominidae)         Chimpanzees are found in west and central Africa. They can be located on either side of the Congo River. Their natural habitats are mainly rainforests. They do most of their eating and sleeping in the forest canopy.  They also reside in swamps, savannas, woodlands, and bamboo forests. They move about both in trees and on the ground equally.

  

B.Lemurs (Prosimians/Strepsirhini)   Arboreal quadrupedalism, terrestrial  quadrupedalism, leaping and suspension.

Spider Monkey (New World Monkey/Platyrrhini)    Arboreal quadrupedalism, terrestrial quadrupedalism, brachiation, leaping and suspension.

Baboon (Old World Monkey/Cercopithecidae)        Arboreal quadrupedalism and terrestrial  quadrupedalism

Gibbon (Lesser ape/Hylobatidae)        Arboreal quadrupedalism, terrestrial  quadrupedalism, brachiation, and suspension.

Chimpanzee (Great ape/Hominidae)         Arboreal quadrupedalism, terrestrial quadrupedalism, knuckle walking, bipedalism brachiation, and leaping.

C.Lemurs (Prosimians/Strepsirhini) Lemurs have been widely affected by the environment of Madagascar.  Lemurs started off by walking on all fours to being able to leap from tree to tree. Their long claws help the Lemur to  climb fast and their tail is used for balance.  Lemurs wet nose is used to help them find the food they need and they have big eyes to help see at night since they are nocturnal.

Spider Monkey (New World Monkey/Platyrrhini)    rainforest gives the Spider Monkey all the needs for survival.  Since the Spider Monkey has long limbs they are able to swing away from their predators in a fast motion if needed to.  They are able to reach their food with their long limbs.  They are also able to stand on their hind legs to see predators in the distance with the balance help of their tail.

Baboon (Old World Monkey/Cercopithecidae) Due to the Baboons habitat, I do believe that over time the Baboon developed a better way of living.  Their stocky build helped them to scare away unwanted predators.  Liiving on a flatland helped them develop strength and speed.  Overall, I believe that the flatland terrain helped these Baboons develop into a better and stronger species.

Gibbon (Lesser ape/Hylobatidae)  The tropical forests helps these Gibbons to survive.  Because they stay up in the trees most of their time they do not attract predators.  I believe that over time Gibbons were able to build up their speed with the growth of their arms.  Since they are light weight it is easier for them to swing so fast.  

Chimpanzee (Great ape/Hominidae) Due to the wide range of habitats for the Chimps it has allowed them to almost adapt to anything.  Chimps can be found in dry land and moist land.  The adaptation of these environments makes the Chimp interesting.

The Environment played a huge role in the adaptations for these locomotor patterns. Individually each primate had to adapt to its surroundings some walk on all four limb and have the limbs to brachiate and some like the baboon learned to strengthen itself being on land. The spider Monkey can swing from tree to tree using all four limbs and even more. these adaptations are astonishing since they resemble similar traits as humans when it comes to adapting. 

Blog Post

1.Two different species that posses homologous traits would be the forlimbs of a frog and a lizard.

B. The similarities that they both share are their forlimbs they maybe different due each having ddifferent lifestyles but they all share the same set of bones the Humerous, the radius, and the ulna.. they both can adapt to water land or a desert land.  both having tadpole babies that look very similar to one another in very first days of life.  Both are amphibian and have a vertebrate.  They both rely on long, snake-like tongues to catch their prey.  Though they may both be classified as amphibians and share similar traits. The Lizard comes from more of  reptile family and frog don't have scales like they do but are very similar down the road.

C. eusthenopteron is the common ancestor they share because of the same bone structure they all have containing the humerous , ulna and the radius. Eusthenopteron, genus of extinct lobe-finned fishes (crossopterygians) preserved as fossils in rocks of the late Devonian Period (about 370 million years ago).Eusthenopteron was near the main line of evolution leading to the first terrestrial vertebrates, the tetrapods. It was 1.5 to 1.8 metres (5 to 6 feet) long and was an active carnivore, with numerous small teeth in its broad skull. 
http://www.britannica.com/EBchecked/topic/196682/Eusthenopteron

D. 

2. two different species who possess the analogous trait the legs of the frog and the grass hopper.

B.  average frog looks quite like a grasshopper, who are also typically green. They also walk or hop the same way the back of the leg is folded and ready to expand to create a bigger bounce in their step. obviously one bounces higher than the other. one is amphibian and the other is an insect. The frog is the predator and the grass hopper is the prey and they both have eyes on their sides as well.

C. They do not have a common ancestor these two are completly different showing no origin of similar or sharing an ancestor.

D.

**DNA Molecule

** DNA Molecule
ATTGTACCAAGTTAGCTTGACACAAGTAATGTCTAACTCTATCGCCG

one of Charles Darwin's biggest influences for his theory on natural selection would be Jean Baptiste Lamarck because he was one of the first to propose that humans evolved from a lower species through adaptations over time. some of his theories weren't correct but even then Darwin adopted his ideas as his own.

Lamarck published a series of books on invertebrate zoology and paleontology which on one the series states his theories on evolution. which represented a great advance over existing classifications; was the first to separate the crustacea, arachnida, and annelida from the insecta. His characteristics of the mollusks was so far ahead of anything else before it.he also concluded the work of schleidon and schwann in cell theory stating that "nobody can have life if its constituent parts are not cellular tissue or are not formed by cellular tissue".

http://www.ucmp.berkeley.edu/history/lamarck.html

his evolution theory was rooted in the idea that life started out as simple and built up until it turned to a complex human form. he was impressed by how the animals he experimented with shared some similarities with it. these things made him think that life was not fixed he strongly believed that each species had to adapt to its environment.

without this theory darwin wouldn't have been able to develop his theory of natural selection as it states Darwin adopted his theories as his own with a slight difference in Jean's mistakes.

darwin was a respectable man for the church and used the bible as one of his explanation it caused a great hullabaloo with the christian church.