Blog Post

1.Two different species that posses homologous traits would be the forlimbs of a frog and a lizard.

B. The similarities that they both share are their forlimbs they maybe different due each having ddifferent lifestyles but they all share the same set of bones the Humerous, the radius, and the ulna.. they both can adapt to water land or a desert land.  both having tadpole babies that look very similar to one another in very first days of life.  Both are amphibian and have a vertebrate.  They both rely on long, snake-like tongues to catch their prey.  Though they may both be classified as amphibians and share similar traits. The Lizard comes from more of  reptile family and frog don't have scales like they do but are very similar down the road.

C. eusthenopteron is the common ancestor they share because of the same bone structure they all have containing the humerous , ulna and the radius. Eusthenopteron, genus of extinct lobe-finned fishes (crossopterygians) preserved as fossils in rocks of the late Devonian Period (about 370 million years ago).Eusthenopteron was near the main line of evolution leading to the first terrestrial vertebrates, the tetrapods. It was 1.5 to 1.8 metres (5 to 6 feet) long and was an active carnivore, with numerous small teeth in its broad skull. 
http://www.britannica.com/EBchecked/topic/196682/Eusthenopteron

D. 

2. two different species who possess the analogous trait the legs of the frog and the grass hopper.

B.  average frog looks quite like a grasshopper, who are also typically green. They also walk or hop the same way the back of the leg is folded and ready to expand to create a bigger bounce in their step. obviously one bounces higher than the other. one is amphibian and the other is an insect. The frog is the predator and the grass hopper is the prey and they both have eyes on their sides as well.

C. They do not have a common ancestor these two are completly different showing no origin of similar or sharing an ancestor.

D.

**DNA Molecule

** DNA Molecule
ATTGTACCAAGTTAGCTTGACACAAGTAATGTCTAACTCTATCGCCG

one of Charles Darwin's biggest influences for his theory on natural selection would be Jean Baptiste Lamarck because he was one of the first to propose that humans evolved from a lower species through adaptations over time. some of his theories weren't correct but even then Darwin adopted his ideas as his own.

Lamarck published a series of books on invertebrate zoology and paleontology which on one the series states his theories on evolution. which represented a great advance over existing classifications; was the first to separate the crustacea, arachnida, and annelida from the insecta. His characteristics of the mollusks was so far ahead of anything else before it.he also concluded the work of schleidon and schwann in cell theory stating that "nobody can have life if its constituent parts are not cellular tissue or are not formed by cellular tissue".

http://www.ucmp.berkeley.edu/history/lamarck.html

his evolution theory was rooted in the idea that life started out as simple and built up until it turned to a complex human form. he was impressed by how the animals he experimented with shared some similarities with it. these things made him think that life was not fixed he strongly believed that each species had to adapt to its environment.

without this theory darwin wouldn't have been able to develop his theory of natural selection as it states Darwin adopted his theories as his own with a slight difference in Jean's mistakes.

darwin was a respectable man for the church and used the bible as one of his explanation it caused a great hullabaloo with the christian church.